Nukleinsäure
TGACTGTGAACGTTCGAGATGA
Allgemeines
Name CpG 1018
Andere Namen

1018 ISS

Identifikatoren
GenBank

JC507052.1

CAS-Nummer

937402-51-2

PubChem

472404001

Wirkstoffdaten
DrugBank

DB05463

Eigenschaften
Größe

22 Nukleotide, 7150 Da

Taxon

synthetisch

CpG-Oligonukleotid 1018 (auch CpG 1018) ist ein CpG-Oligonukleotid, das an den TLR9 bindet und daher in der Immunologie und Pharmakologie als Adjuvans verwendet wird.

Eigenschaften

CpG 1018 wird synthetisch per Phosphoramidit-Methode hergestellt. CpG 1018 ist ein CpG-Oligonukleotid der Klasse B und hat die Sequenz: 5′-TGACTGTGAACGTTCGAGATGA-3′. Das erste CG in der Sequenz wirkt am TLR-9 in Nagetieren, während das zweite in Primaten wirksam ist. Das Phosphodiester-Desoxyribose-Rückgrat ist hierbei zu einem Phosphorthioat modifiziert. Dabei wird ein nicht an der Phosphatbrücke beteiligtes Sauerstoffatom durch ein Schwefelatom ersetzt. Dadurch wird es resistenter gegenüber DNasen. CpG 1018 erzeugt bei einer Immunisierung eine TH1-gerichtete Immunantwort mit einer Produktion von Chemokinen, Zytokinen und Antikörpern in NK-Zellen, pDC und B-Zellen.

Anwendungen

CpG 1018 wird bei VLA2001 eingesetzt, einem COVID-19-Impfstoff in Form eines inaktivierten Virus gegen das Coronavirus SARS-CoV-2 des Herstellers Valneva. Beim monovalenten Hepatitis-B-Impfstoff Heplisav-B ist CpG 1018 als Adjuvans enthalten.

Literatur

  • Immunostimulatory DNA–Dynavax. AIC, Amb a 1 immunostimulatory conjugate, HBV-ISS, ISS 1018, ISS DNA, ISS DNA–dynavax, ISS1, ISS2. In: Drugs in R&D. Band 3, Nummer 3, 2002, S. 193–196, doi:10.2165/00126839-200203030-00011, PMID 12099166
  • A. M. Krieg, A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman: CpG motifs in bacterial DNA trigger direct B-cell activation. In: Nature. Band 374, Nummer 6522, April 1995, S. 546–549, doi:10.1038/374546a0, PMID 7700380.

Einzelnachweise

  1. ↑ Jason D. Marshall, Karen Fearon, Christi Abbate, Sandhya Subramanian, Priscilla Yee, Josh Gregorio, Robert L Coffman, Gary Van Nest: Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions In: Journal of leukocyte biology. Band 73, Nummer 6, Juni 2003, S. 781–792, doi:10.1189/jlb.1202630, PMID 12773511.
  2. ↑ Jingxing Yang, Jen-Chih Tseng, Guann-Yi Yu, Yunping Luo, Chi-Ying F. Huang, Yi-Ren Hong, Tsung-Hsien Chuang: Recent Advances in the Development of Toll-like Receptor Agonist-Based Vaccine Adjuvants for Infectious Diseases. In: Pharmaceutics. 2022, Band 14, Nummer 2, S. 423 doi:10.3390/pharmaceutics14020423. PMID 35214155. PMC 8878135 (freier Volltext).
  3. 1 2 3 John D. Campbell: Development of the CpG Adjuvant 1018: A Case Study. In: Methods in Molecular Biology (Clifton, N.J.). Band 1494, 2017, S. 15–27, doi:10.1007/978-1-4939-6445-1_2, PMID 27718183.
  4. ↑ Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto jr., Lubert Stryer: Stryer Biochemie. Katalytische Strategien. 8. Auflage. Springer, 2018, ISBN 978-3-662-54619-2, S. 321, doi:10.1007/978-3-662-54620-8_9.
  5. ↑ A. Facciolà, G. Visalli, A. Laganà, A. Di Pietro: An Overview of Vaccine Adjuvants: Current Evidence and Future Perspectives. In: Vaccines. Band 10, Nummer 5, Mai 2022, S. , doi:10.3390/vaccines10050819, PMID 35632575, PMC 9147349 (freier Volltext).
  6. ↑ M. Roman, E. Martin-Orozco, J. S. Goodman, M. D. Nguyen, Y. Sato, A. Ronaghy, R. S. Kornbluth, D. D. Richman, D. A. Carson, E. Raz: Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. In: Nature medicine. Band 3, Nummer 8, August 1997, S. 849–854, doi:10.1038/nm0897-849, PMID 9256274.
  7. ↑ Valneva Provides Regulatory Update on its COVID-19 Vaccine Candidate. In: Mitteilung. Valneva SE, 11. März 2022, abgerufen am 2. April 2022.
  8. ↑ Heplisav B. In: EMA. Abgerufen am 10. Juli 2022 (englisch).
This article is issued from Wikipedia. The text is licensed under Creative Commons - Attribution - Sharealike. Additional terms may apply for the media files.